View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056_high_9 (Length: 237)
Name: NF3056_high_9
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 39630105 - 39629889
Alignment:
| Q |
1 |
ccaacttctttgttgttggtgtttggtggtcttggagaaataggaactcaagttgnnnnnnnaatgtttcgattccaacttaccatcttgccatggaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
39630105 |
ccaacttctttgttgttggtgtttggtggtcttggagaaataggaactcaagttgtttttttaatgtttcgatttcaacttaccatc-----atggaagc |
39630011 |
T |
 |
| Q |
101 |
tcacaacttataacacactttcaacatttactttccaagatcaccagttcaccacccacataccttgaggatatattggtccaatgaaactcttcaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630010 |
tcacaacttataacacactttcaacatttactttccaagatcactagttcaccacccacataccttgaggatatattggtccaatgaaactcttcaaatc |
39629911 |
T |
 |
| Q |
201 |
atatttgcaccatcatcaatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39629910 |
atatttgcaccatcatcaatgt |
39629889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University