View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056_low_6 (Length: 259)
Name: NF3056_low_6
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 30 - 172
Target Start/End: Original strand, 1502479 - 1502635
Alignment:
| Q |
30 |
gattatacttgagatgtgaacaatgaacatgtgcaataatggactacacgatcgagttgttggagtggaagaagtggtatcaatgtaatacaagatcaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1502479 |
gattatacttgagatgtgaacaatgaacatgtgcaataatggactacacgatcgagttgttggagtggaagaagtggtatcaatgtaatacaagatcata |
1502578 |
T |
|
| Q |
130 |
t--------------taatatgattttacattgcaactacatttaatattgtttgta |
172 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1502579 |
ttattagtatgacactaatatgattttacattgcaactatatttaatattgtttgta |
1502635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 163 - 238
Target Start/End: Original strand, 1502793 - 1502868
Alignment:
| Q |
163 |
attgtttgtattatgtaactatgttgagagtggagttgaactctcaacctccttaccatctcacttctattaaatc |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1502793 |
attgtttgtattatgtaactatattgagagtggagttgaactctcaacctccttaccatctcacttctattaaatc |
1502868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University