View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_high_17 (Length: 279)
Name: NF3057_high_17
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 32183822 - 32184003
Alignment:
| Q |
1 |
catgtcagctacttgaaaacaaaggtcttgttctgctgcctattgctttggttgatgaactcaaccaagctatgcaatggttgaaccaagctagctagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
32183822 |
catgtcagctacttgaaaacaaaggtcttgttctgctgcctattgctttggttgatgaactgaaccaggctatgcaatggttgaaccaagctagctagat |
32183921 |
T |
 |
| Q |
101 |
aactatttatttttac---tctccactatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac |
179 |
Q |
| |
|
|||||||| ||||| | ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183922 |
aactattttttttttcttttctgcattatggttgatttatattttgtatgtttggattattaggtatgtgaaccaagctaac |
32184003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 273
Target Start/End: Original strand, 32184000 - 32184049
Alignment:
| Q |
222 |
taactcttgaaaatctatggtgctcaaaggtggcatgtgtgttactgtttct |
273 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
32184000 |
taactcttgaaaatctatggtactcagaggtgg--tgtgtgttactgtttct |
32184049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University