View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_high_18 (Length: 264)
Name: NF3057_high_18
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 7099580 - 7099336
Alignment:
| Q |
10 |
aaatttgtttcataatccaaaaatcttatctaaagatacttaactcttagcctcgaagttttataagagttccttcctttg-----gtgtcatgagatta |
104 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7099580 |
aaatgtgtttcataatccaaaaatattatctaaagatactcaactcttagcctcgaagttttataagagttccttcctttcctttagtgtcatgagatta |
7099481 |
T |
|
| Q |
105 |
gccacaaaagaatgagaaaaagttgattttataggtacatatcccgagacatgcgtccaacaaccaaccaacatgaacaatgactcatcatattagatct |
204 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7099480 |
gccacaaaagaatgagaaaaggctgattttataggtacatatcccgagacatgcgcccaacaaccaaccaacataaacaatgactcatcatattagatct |
7099381 |
T |
|
| Q |
205 |
atttagatcaacgagtgccctacaatgggcttgaacctaataatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7099380 |
atttagatcaacgagtgccctacaatgggcttgaacctaataatt |
7099336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University