View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_high_25 (Length: 228)
Name: NF3057_high_25
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_high_25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 42275881 - 42276110
Alignment:
| Q |
1 |
caatttggacaatattattggacacgtatggatgcctacaaattacatgtcggtattcttatttacaatgttcaacttctcatttatgcagtatggaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
42275881 |
caatttggacaatattattggacacgtatggatgcctacaaattacatgtcggtattcttatttacaaggttgaacttctcatttatgcagtatggaatc |
42275980 |
T |
|
| Q |
101 |
aacttagactatcacaaaattagtagaatatccttttctannnnnnncttcttgtgtaaatcggataggatagggccacgtgatgagaca--gctctctc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
42275981 |
aacttagactatcacaaaattagtagaatatccttttctatttttttcttcttgtgtaaatcggataggatagggccacatgatgagacacctctctctc |
42276080 |
T |
|
| Q |
199 |
atattttcaagagaaatgatatttgtacaa |
228 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
42276081 |
atatttttaagagaaatgatatttgtacaa |
42276110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University