View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_low_13 (Length: 334)
Name: NF3057_low_13
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 43256968 - 43256660
Alignment:
| Q |
18 |
caagtttaccttttgttttgtttcgttttctcaatggagaaagtggtttcttacttgtcttccttgttcagttatcctttcttgtttgtgtttggtcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256968 |
caagtttaccttttgttttgtttcgttttctcaatggagaaagtggtttcttacttgtcttccttgttcagttatcctttcttgtttgtgtttggtcttt |
43256869 |
T |
|
| Q |
118 |
cactcttttgtggttttaaattattctttttgactaaaatcatgaagnnnnnnntaaagtatttggaaagtacaagagggtcgttgaagttcccaaaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256868 |
cactcttttgtggttttaaattattctttttgactaaaatcatgaagaaaaaaataaagtatttggaaagtacaagagggtcgttgaagttcccaaaaat |
43256769 |
T |
|
| Q |
218 |
agcggttacnnnnnnnnnnnncatctccacaatacccttttagagtcttcatgcaaatgaagtcaaaaagggtaaattggatatttcaaattatcattgc |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256768 |
agcggttacttttttgtttttcatctccacaatacccttttagagtcttcatgcaaatgaagtcaaaaagggtaaattggatatttcaaattatcattgc |
43256669 |
T |
|
| Q |
318 |
atctctgct |
326 |
Q |
| |
|
||| ||||| |
|
|
| T |
43256668 |
atcactgct |
43256660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 43254895 - 43254852
Alignment:
| Q |
183 |
gaaagtacaagagggtcgttgaagttcccaaaaatagcggttac |
226 |
Q |
| |
|
|||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
43254895 |
gaaagtacaacagggtcgttgaagttccccaatatagcggttac |
43254852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University