View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_low_22 (Length: 240)
Name: NF3057_low_22
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 34761460 - 34761332
Alignment:
| Q |
1 |
aatttataggaataatgttaatgaaaagtattattgaagttcttttttactagtattattgaagatatagctagcaaaatgatataaatttatgaatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34761460 |
aatttataggaataatgttaatgaaaagtattattgaagttcttttttactagtattattgaagatatagctagcaaaatgatataaatttatgaatgta |
34761361 |
T |
|
| Q |
101 |
aatatatattttatgttctttttacgttc |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
34761360 |
aatatatattttatgttctttttatgttc |
34761332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University