View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3057_low_29 (Length: 204)
Name: NF3057_low_29
Description: NF3057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3057_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 42223113 - 42222923
Alignment:
| Q |
14 |
gaatggaaaggaaaatggaaccatttcaagtcagagtaaggttcagaagaatagaattgatatgcccattgtaaaacatccagcggccacccaagggctt |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42223113 |
gaatggaaaggaaaatggaaacatttcaagtcagagtaaggttcagaagaatagaattgatacgcccattgtaaaacatccaacggccacccaagggctt |
42223014 |
T |
 |
| Q |
114 |
aaacgttcacctgcgcaataacatgtaaactaaagtagacaataaatctcaaatagatgataagccacactagaagaccacaatgcaactc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
42223013 |
aaacgttcacctgcgcaataacatgtaaactaaagtagtcaataaatctcgaatagaggaaaagccaaactagaagaccacaatgcaactc |
42222923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University