View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060-Insertion-31 (Length: 145)
Name: NF3060-Insertion-31
Description: NF3060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060-Insertion-31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 6 - 141
Target Start/End: Complemental strand, 45522641 - 45522506
Alignment:
| Q |
6 |
cagtaacgtattattagttcaaagacatatttatttaagcaaacaaatattccgtttaagaaaatctaaattgtatctcacaaactaaactagtactaaa |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45522641 |
cagtaacatattattagttcaaagacatatttaattaagcaaacaaatattccgtttaagaaaatctaaattgtatctcacaaactaaactagtactaaa |
45522542 |
T |
 |
| Q |
106 |
aaataatcatacggttatattagtttcatatactac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45522541 |
aaataatcatacggttatattagtttcatatactac |
45522506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University