View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060-Insertion-35 (Length: 69)
Name: NF3060-Insertion-35
Description: NF3060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060-Insertion-35 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0479 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 33814363 - 33814300
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccacg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33814363 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcttcatagaataccacg |
33814300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 54969684 - 54969746
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccac |
68 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
54969684 |
cacaatggcctttggcttattagattgaatgtcgtggattgtctgatcttcatagaataccac |
54969746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 13563961 - 13564023
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccac |
68 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
13563961 |
cacaatggcctttggcttattagattgaatgtcgtgaattgtctgatcttcatagaataccac |
13564023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0479 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: scaffold0479
Description:
Target: scaffold0479; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 463 - 401
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccac |
68 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
463 |
cacaatggcctttggcttattagattgaatgtcgtgtattgtctgatcttcatagaataccac |
401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 4837988 - 4838050
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccac |
68 |
Q |
| |
|
|||||| | ||||||||| |||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4837988 |
cacaatcgcctttggcttattagattgaatgtcgtggattgtctgatcttcatagaataccac |
4838050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 9754782 - 9754844
Alignment:
| Q |
6 |
cacaatggtctttggctttttagattgaatgtcgtggatcgtctgatcctcatagaataccac |
68 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
9754782 |
cacaatggcctttggcttattagattgaatgtcgtggattgtctaatcttcatagaataccac |
9754844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University