View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060-Insertion-6 (Length: 201)
Name: NF3060-Insertion-6
Description: NF3060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 6 - 201
Target Start/End: Original strand, 7869475 - 7869670
Alignment:
| Q |
6 |
catccacctcatcaaatgttttcaaaattgaacatacatgaatcgattcccatatcgaaaatcttagtgaaagttttccgagactaaccgaaacaaaaat |
105 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
7869475 |
catccacctcataaaatgttttcagaattgaacatacatgaatcgattcccatatcgaaaatcttagtgaaagtttcccgagactaacccaaacaaaaat |
7869574 |
T |
 |
| Q |
106 |
catagagaaactaaaatacaataattagcactaatctatgatcaaatgacctatcaaccactccttcaattatatcacaacattcttccttcttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7869575 |
catagagaaactaaaatacaataattagcactaatctataatcaaatgacctatcaaccactccttcaattatatcacaacattcttccttcttct |
7869670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University