View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-27 (Length: 124)
Name: NF3060R-Insertion-27
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-27 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 2e-59; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 6070483 - 6070598
Alignment:
| Q |
9 |
cttattagattgatcaacatacaatcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6070483 |
cttattagattgatcaacatacaatcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
6070582 |
T |
|
| Q |
109 |
tcttcctttattttcc |
124 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6070583 |
tcttcctttattttcc |
6070598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 67 - 124
Target Start/End: Complemental strand, 6055877 - 6055820
Alignment:
| Q |
67 |
aaatagccaggtggcaccactcgaatttcaactccattcatctcttcctttattttcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6055877 |
aaatagccaggtggcaccactcgaatttcaactccatgcatctcttcctttattttcc |
6055820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 9 - 122
Target Start/End: Original strand, 6085559 - 6085672
Alignment:
| Q |
9 |
cttattagattgatcaacatacaatcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | | | |||||||||||||||| | |||| ||||||||| |||||||||||||| || |
|
|
| T |
6085559 |
cttattagattcatcaacatacaatcgaactctcttgaacctgaaatcagcagtaacaaatgaatcagggggcaccacttgaatttcaactccagatata |
6085658 |
T |
|
| Q |
109 |
tcttcctttatttt |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6085659 |
tcttcctttatttt |
6085672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 9 - 41
Target Start/End: Complemental strand, 6055920 - 6055888
Alignment:
| Q |
9 |
cttattagattgatcaacatacaatcgaactct |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6055920 |
cttattagattgatcaacatacaatcgaactct |
6055888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University