View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-28 (Length: 138)
Name: NF3060R-Insertion-28
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 9 - 138
Target Start/End: Complemental strand, 48250845 - 48250715
Alignment:
| Q |
9 |
gaactaacactgtgcctgcacttgctgcaaccgccattgtctctcacttttcttcactgttatcctt-ttttcctatgttaagaattaagattcaatgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48250845 |
gaactaacactgtgcctgcacttgctgcaaccgccattgtctctcacttttcttcactgttatcctttttttcctatgttaagaattaagattcaatgtt |
48250746 |
T |
 |
| Q |
108 |
tttgtttgtttgaggaaaatagagaaaccac |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48250745 |
tttgtttgtttgaggaaaatagagaaaccac |
48250715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University