View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-29 (Length: 140)
Name: NF3060R-Insertion-29
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 9e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 9 - 140
Target Start/End: Complemental strand, 46736740 - 46736609
Alignment:
| Q |
9 |
ccataaacgacaatgacttacttaatgtacataataatactcattaaaaattgagtatgactattatgggccacgagcaggtttaaaacaaaaacaaaat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736740 |
ccatagacgacaatgacttacttaatgtacataattatactcattaaaaattgagtatgattattatgggccacgagcaggtttaaaacaaaaacaaaat |
46736641 |
T |
 |
| Q |
109 |
ggagtctggtcttctcttatcattccgcctcc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46736640 |
ggagtctggtcttctcttatcattccgcctcc |
46736609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University