View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-30 (Length: 165)
Name: NF3060R-Insertion-30
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 8e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 8e-72
Query Start/End: Original strand, 10 - 165
Target Start/End: Complemental strand, 41657032 - 41656874
Alignment:
| Q |
10 |
gttagtaagaggatagtttaggctttttgagggggataccatgcataaattttttattctttgtgtgaaaggtg---tagtcttttatataaggggatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41657032 |
gttagtaagaggatagtttaggctttttgagggggataccatgcataaattttttattttttgtgtgaaaggtggtgtagtcttttatataaggggatag |
41656933 |
T |
 |
| Q |
107 |
atacccttggaagaggtatctctgttctcaatcgttccttcaacaaaagttctttctct |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41656932 |
atacccttggaagaggtatctctgttctcaatcgttccttcagcaaaagttctttctct |
41656874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University