View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-33 (Length: 267)
Name: NF3060R-Insertion-33
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 35437557 - 35437790
Alignment:
| Q |
8 |
agttataaaagggtagtaattgatgtatgttcatggagaacttttgaaatcaattttttgtaactttttaaaatcttttataaagatt-attgatagtgt |
106 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||| ||| |
|
|
| T |
35437557 |
agttataaaagggtagaaattgaggtatgttcatggagaacttttgaaattaattttttgtaactttttaaaatcttttaagaagatttattgatattgt |
35437656 |
T |
|
| Q |
107 |
gtttgaaaagttactatccccttcaaatgtagatcaatttagaccgaattagataaaacattatcttggtatgtttgttctagtactttctttatctttg |
206 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35437657 |
gtttgaaaaattaccatctccttcaaatgtagatcaatttaggtcgaattggataaaacattatcttggtatgtttgttctagtactttctttatctttg |
35437756 |
T |
|
| Q |
207 |
ttcttaattgatgatttatcatgctcacaggttc |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
35437757 |
ttcttaattgatgatttatcatgctcataggttc |
35437790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University