View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060R-Insertion-34 (Length: 290)
Name: NF3060R-Insertion-34
Description: NF3060R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060R-Insertion-34 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 221 - 290
Target Start/End: Complemental strand, 28742196 - 28742127
Alignment:
| Q |
221 |
tcgaaggatagggttcgtcttggaaggtgttgctgcttccgtgtgttggttgttttttcttgcctttgat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28742196 |
tcgaaggatagggttcgtcttggaaggtgttgctgcttacgtgtgttggttgttttttcttgcctttgat |
28742127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 53 - 117
Target Start/End: Complemental strand, 28742264 - 28742200
Alignment:
| Q |
53 |
tacatattgtctatgcgcggtgttagtggcggcttgttggtgtgctgctagatcatgttctgaat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28742264 |
tacatattgtctatgagcggtgttagtggcggcttgttggtgtgttgctagatcatgttctgaat |
28742200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University