View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3060_low_6 (Length: 217)
Name: NF3060_low_6
Description: NF3060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3060_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 45066589 - 45066407
Alignment:
| Q |
16 |
cacatacctggtataggcaattggacaagtttattcactatgttaaccaggttgcttatcttcaactctttgcttaataaaaaagtttaaaatttaagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066589 |
cacatacctggtataggcaattggacaagtttattcactatgttaaccaggttgcttatcttcaactctttgcttaataaaaaagtttaaaatttaagtt |
45066490 |
T |
|
| Q |
116 |
tatttcgccaagcgtcctttgacatactaatggtccggctcactaatgcttatttaggatggacgggttcatgccttatactc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45066489 |
tatttcgccaagcgtcctttgacatactaatggtccggctcactaatgcttatttaggatggacgggttcatgccttatactc |
45066407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University