View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_high_23 (Length: 262)
Name: NF3061_high_23
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_high_23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 70 - 262
Target Start/End: Complemental strand, 9715235 - 9715043
Alignment:
| Q |
70 |
aaataccttgatacgtcagaagaaaaagatgaatgcccttcattggatggagtctccatctttctatgcatcaatcctgaatccaaaccttcctttgcct |
169 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9715235 |
aaataccttgatttgtcagaagaaaaagataaatgcccttcattggatggagtctccatctttctatgcatcaatcttgaatccaaaccttcctttgcct |
9715136 |
T |
 |
| Q |
170 |
cagcagtaaaattggaaaagacactggatttagcttcacaatcaaaacatgtttttatattgtaatcacttatactcgcatatgattgttctc |
262 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
9715135 |
cagcagcaaaattggaaaagatgctagatttagcttcacaatcaaaacatgtttttatattgtaatcacttattcccgcatatgattgttctc |
9715043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University