View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_high_27 (Length: 251)
Name: NF3061_high_27
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 28226395 - 28226158
Alignment:
| Q |
1 |
cagatttcagaaaggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226395 |
cagatttcagaaaggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttttcgatttcttatgattctttagaatatgatgcata |
28226296 |
T |
|
| Q |
101 |
tgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226295 |
tgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaac |
28226196 |
T |
|
| Q |
201 |
attctgcaactccaagaaatttagagatctttaggttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226195 |
attctgcaactccaagaaatttagagatctttaggttc |
28226158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 130 - 230
Target Start/End: Original strand, 13040378 - 13040478
Alignment:
| Q |
130 |
attcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatc |
229 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||| | || |||||||||||| |
|
|
| T |
13040378 |
attcacctcaaggtagatgtcaatggctctatagaccccatcaaagcaatcccttgcaaaatcaggcaaacattctacaacttctaggaatttagagatc |
13040477 |
T |
|
| Q |
230 |
t |
230 |
Q |
| |
|
| |
|
|
| T |
13040478 |
t |
13040478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University