View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_high_28 (Length: 251)
Name: NF3061_high_28
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 9659858 - 9659667
Alignment:
| Q |
1 |
taacaatttatattcacaatctcaacttgtatcaatataattttatttccacttttctctcttaaatgctaaatatcaatattttgctgcatcttctatt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9659858 |
taacaatttcaattcacaatctcaacttctatcaatataattttatttccacttttctctcttaaatgctaa-tatcaatattttgctgcatcttctatt |
9659760 |
T |
 |
| Q |
101 |
atgaatattgatattat--gtatctgtgtatgcatgcataccaagcgatcaatgtataaaggtatctcatgctgtcaataaaaatcaaccctttagt |
195 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9659759 |
atgaatattgatattatatgtatccgtgtatgcat----accaagcgatcaatgtataaaggtaactcatgctgtcaataaaaatcaaccctttagt |
9659667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 35999977 - 36000025
Alignment:
| Q |
39 |
aattttatttccacttttctctcttaaatgctaaatatcaatattttgc |
87 |
Q |
| |
|
||||||| ||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
35999977 |
aattttacttccacttttctctcttcggtgcttaatatcaatattttgc |
36000025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University