View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_high_32 (Length: 239)
Name: NF3061_high_32
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10147487 - 10147268
Alignment:
| Q |
1 |
aaaggcaaattattgattgtacgatatcaaagattaatggattggattagtggtggatctaaaatatattcttcttaatggaacnnnnnnnnnngttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
10147487 |
aaaggcaaattattgattgtacgatataaaagattaatggattggattagtggtggatctaaaatat---cttcttaatggaacaaaaaaaatagttatt |
10147391 |
T |
|
| Q |
101 |
gttatgaaattaatcaaaattagagtaatgcagagtacatagtccctgcagctaccgactatacctacgtgataaataatacttaattcttaatgtgaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10147390 |
gttatgaaattaatcaaaattagagtaatgcagagtacatagtccttgcagctaccgactatacctacgtgataaataatacttaattcttaatgtgaac |
10147291 |
T |
|
| Q |
201 |
taacacaaactattagagataaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10147290 |
taacacaaactattagagataaa |
10147268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University