View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_15 (Length: 385)
Name: NF3061_low_15
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 332; Significance: 0; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 18 - 373
Target Start/End: Complemental strand, 13726246 - 13725891
Alignment:
| Q |
18 |
gaaagttggaccaaaatcactttctcagcttcttcataaacttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctttcttacattggact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13726246 |
gaaagttggaccaaaatcactttctcagcttcttcataaacttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctttcttaaattggact |
13726147 |
T |
 |
| Q |
118 |
tttgatgtctccaagagttttggaatccctgttgctgttttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattg |
217 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726146 |
tttgatgtctctaagagttttgaaatccctgttgctgttttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattg |
13726047 |
T |
 |
| Q |
218 |
agttgccaatttcgaagagtgaaattgtgttacctggattgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctgg |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726046 |
agttgccgatttcgaagagtgaaattgtgttacctggattgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctgg |
13725947 |
T |
 |
| Q |
318 |
ttactttgatattcttacaaaccaattttcaaagattgatcaagctgattgggttc |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
13725946 |
ttactttgatattcttacaaaccaattttccaagattgatcaagttgattgggttc |
13725891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 147 - 373
Target Start/End: Complemental strand, 13697093 - 13696867
Alignment:
| Q |
147 |
tgttgctgttttcttaactcaagcttgttctgttaataccataaattttcatgcttttatgaaatggattgagttgccaatttcgaagagtgaaattgtg |
246 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||| | |||| | || || || | | | ||| ||||||||| |
|
|
| T |
13697093 |
tgttgctgtttttttaactcaagcttgttgtgttaatagtataaattttcatgcttttaagggatggttggatttacctttgttggagaaagaaattgtg |
13696994 |
T |
 |
| Q |
247 |
ttacctggattgccaacgcttcaagatgctgatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaatttt |
346 |
Q |
| |
|
|||||||||||||| | |||| ||| |||||||||||||||||| |||||| |||||||||| |||||||||||||||||||| | || |||||||||| |
|
|
| T |
13696993 |
ttacctggattgcctaagcttgaagctgctgatttgccttcttttttgtataaatatggaactcatcctggttactttgatattttgactaaccaatttt |
13696894 |
T |
 |
| Q |
347 |
caaagattgatcaagctgattgggttc |
373 |
Q |
| |
|
||| ||||||||||| ||||||||||| |
|
|
| T |
13696893 |
caatgattgatcaagttgattgggttc |
13696867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 13686840 - 13686889
Alignment:
| Q |
277 |
gatttgccttctttcttgtatcaatatggaacctatcctggttactttga |
326 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| || |||||||| |
|
|
| T |
13686840 |
gatttgccttctttcttgtataaatatggatcctatccgggatactttga |
13686889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 369
Target Start/End: Complemental strand, 13673072 - 13672980
Alignment:
| Q |
277 |
gatttgccttctttcttgtatcaatatggaacctatcctggttactttgatattcttacaaaccaattttcaaagattgatcaagctgattgg |
369 |
Q |
| |
|
|||||||||||||| |||||| |||||||| | ||||| || ||||||||||| || || ||||||||||| |||| | ||||||||||| |
|
|
| T |
13673072 |
gatttgccttcttttttgtataaatatggatcttatccaggctactttgatatagttgtcaatcaattttcaaacattggtaaagctgattgg |
13672980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 314
Target Start/End: Original strand, 13693304 - 13693341
Alignment:
| Q |
277 |
gatttgccttctttcttgtatcaatatggaacctatcc |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
13693304 |
gatttgccttctttcttgtataaatatggatcctatcc |
13693341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University