View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_19 (Length: 320)
Name: NF3061_low_19
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 24974565 - 24974849
Alignment:
| Q |
19 |
tctactcggatgtgaaaaaggttaaagaagaaggaacaaaggtatcaaaatcatacaaggtattcccagaggaacatgaaccatggcgaaaaagaatact |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24974565 |
tctactcggatgtgaaaagggttaaagaagaaggaacaaaggtatcaaaatcatacaaggtattcccagaggaacatgaaccatggcgtaaaagaatact |
24974664 |
T |
|
| Q |
119 |
tgaccctggtagccagattgtgttaaaatggaatcgtctctttatagtttcttgcttgttagctctttttgttgatcccttgtacttttatttgcctatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24974665 |
tgaccctggtagccagattgtgttaaaatggaatcgtctctttatagtttcttgcttgttagctctttttgttgatcccttgtacttttatttgcctatt |
24974764 |
T |
|
| Q |
219 |
gtccaaacaacacaacaaccctcttcttcctgtctgaagactgacctgacattacagattattgtcacctttcttcgcactattg |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24974765 |
gtccaaacaacacaacgaccctcttcttcctgtctgaagactgacctgacattacagattattgtcacctttcttcgcactattg |
24974849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University