View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_33 (Length: 247)
Name: NF3061_low_33
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 233
Target Start/End: Complemental strand, 32604175 - 32603963
Alignment:
| Q |
21 |
ttgatatgaaagaactcagaaaaacaagtactgtataatcttaggaaaacattatcgtactacatttataagactcttttttccacaatcattttttcca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604175 |
ttgatatgaaagaactcagaaaaacaagta-----taatcttgggaaaacattatcgtactacatttataagactcttttttccacaatcattttttcca |
32604081 |
T |
|
| Q |
121 |
cacagttcaaataatgaactatgttgcttttttaagtcttaataa-----tatgttgctttttcccatgtgtgtgtaatcgtaacatgttttccatgtgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32604080 |
cacagttcaaataatgaactatgttgcttttttaagtcttaataatgaactaagttgctttttcccatgtgtgtgtaatcgtaacatgttttccatgtgt |
32603981 |
T |
|
| Q |
216 |
gtgtaatccaagtataat |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32603980 |
gtgtaatccaagtataat |
32603963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 101
Target Start/End: Complemental strand, 32603901 - 32603870
Alignment:
| Q |
70 |
cattatcgtactacatttataagactcttttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32603901 |
cattatcgtactacatttataagactcttttt |
32603870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University