View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_37 (Length: 238)
Name: NF3061_low_37
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 9660100 - 9659881
Alignment:
| Q |
17 |
agaaatcgaaaaggaagaataaatcgaaaaggaaacgtttatagtgtggatggctatggtttggtgtaataacttgttgcttgtattgataatcatgtat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9660100 |
agaaatcgaaaaggaagaataaatcgaaaaggaaacgtttatagtgtggatgactacggtttggtgtaataacttgttgcttgtattgatagccatgtat |
9660001 |
T |
 |
| Q |
117 |
gaaattttagtttttagtctcagaactatgtagtgggttcgagtatcccttttactcttattaataccattttgcttatttaaaatattggtaaatacta |
216 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
9660000 |
g-aattttagtttttagtctcagaacaatgtagtgggttcgagtatcccttttactcttattaataccattttgctta-ttaaaatattggtaactacta |
9659903 |
T |
 |
| Q |
217 |
attatttctccatgatttaact |
238 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
9659902 |
attatttcaccatgatttaact |
9659881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University