View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_39 (Length: 234)
Name: NF3061_low_39
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 44 - 201
Target Start/End: Complemental strand, 48106060 - 48105903
Alignment:
| Q |
44 |
gagataaagttgttagcccacccaactatctcaaaaaacttgaggagattatgcaatatggagaagctactgaaatattatttgccataggattgcaagg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48106060 |
gagataaagttgttagcccacccaactatctcaaaaaacttgaggagattatgcaatctggagaagctactgaaatattatttgccataggattgcaagg |
48105961 |
T |
 |
| Q |
144 |
ccattttgcaagtggccagccaaatcttgcttacatgaagtcaggtctagattttctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48105960 |
ccattttgcaagtggccagccaaatcttgcttacatgaggtcaggtctagattttctt |
48105903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 201
Target Start/End: Complemental strand, 48066421 - 48066357
Alignment:
| Q |
137 |
tgcaaggccattttgcaagtggccagccaaatcttgcttacatgaagtcaggtctagattttctt |
201 |
Q |
| |
|
|||||||||||||| || | ||| |||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
48066421 |
tgcaaggccatttttcacgcggcgtgccaaacattgcttacatgaggtcaggtctagatcttctt |
48066357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University