View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_43 (Length: 225)
Name: NF3061_low_43
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 37207812 - 37207599
Alignment:
| Q |
1 |
aagggttggttaatagtattaattattacacatctcaatcaacatcatactattaatcctataattaggaaataacaaccttgcctaccaacaaagcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37207812 |
aagggttggttaatagtattaattattacacatctcaatcaacatcatactattaatcctataattaggaaataacaaccttgcctaccaacaaagcttt |
37207713 |
T |
 |
| Q |
101 |
atgaagattctcacaaacgtttatagatactcattgctcatgcacgtgtaaatataaactaataaaagtgaaagagnnnnnnnntagtttgaactaagtt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37207712 |
atgaagattctcacaaacgtttagagatgctaattgcttatgcacgtgtaaatataaactaataaaagtgaaagag-aaaaaaatagtttgaactaagtt |
37207614 |
T |
 |
| Q |
201 |
ttgatatgattttct |
215 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
37207613 |
ttgatttgattttct |
37207599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University