View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_45 (Length: 215)
Name: NF3061_low_45
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 24 - 207
Target Start/End: Original strand, 24543707 - 24543890
Alignment:
| Q |
24 |
aagaggcagaggaagattcaattcaagatggagaagatgagctacaacattatttattctcttcccaaggaagagaagatttgagtagtactgttttatc |
123 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24543707 |
aagaggaagaggaagattcaattcaagatggagaagatgagctacaacattatttattctcttcccaaggaagagaagatttgagtagtactgttttatc |
24543806 |
T |
|
| Q |
124 |
tgaagttgctattcttccatgcagtcatatattccacgagacatgtttatctgctttgcccctaactactatctctgctcctcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
24543807 |
tgaagttgctattcttccatgcagtcatatattccacgagacatgtttatctgctttgcccctaactactatcactgatcctcc |
24543890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University