View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3061_low_7 (Length: 457)
Name: NF3061_low_7
Description: NF3061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3061_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 8250563 - 8250289
Alignment:
| Q |
18 |
cgaatgaccacaaaaaatgctacctaccattattggtctctacaacttataaacattataagtggagttcaatgaaagataagaaatgactacattttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250563 |
cgaatgaccacaaaaaatgctacctaccattattggtctctacaacttataaacattataagtggagttcaatgaaagataagaaatgactacattttta |
8250464 |
T |
|
| Q |
118 |
actctaaggtgcccaaggtggaagtggtactggtactggtagtagatgcaatcaagaagctatattgggaatggtttttgggtaataagtcggtttctca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250463 |
actctaaggtgcccaaggtggaagtggtactggta------gtagatgcaatcaagaagctatattgggaatggtttttgggtaataagtcggtttctca |
8250370 |
T |
|
| Q |
218 |
atgtctttacaatgaagggtttatggtttaatttcccctttgattgtatgtcgtgataatatagaccgtgtcagcacttca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250369 |
atgtctttacaatgaagggtttatggtttaatttcccctttgactgtatgtcgtgataatatagaccgtgtcagcacttca |
8250289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University