View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_high_11 (Length: 362)
Name: NF3062_high_11
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 354
Target Start/End: Complemental strand, 37928828 - 37928492
Alignment:
| Q |
19 |
gttggctccatttctcttccttctcatggtggagggcctaagtggggatgttaggagtgcggaagaacgtaatatattctctaggtttagggtgggtaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37928828 |
gttggctccatttctcttccttctcatggtggagggcctaagtggggatgttaggagtgcggaagaacgtaatatattctctaggtttagggtgggtaat |
37928729 |
T |
 |
| Q |
119 |
gtcggtttgtctatgactcacatactatatgtaaatgatatatgttcttatttgggg-aagcattggttaggaatatttagtctttgaaaaacatatcct |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37928728 |
gttggtttgtctatgactcacatactatatgcaaatgatatatgttcttatttgggggaagcattggttaggaatatttagtctttgaaaaacatatcct |
37928629 |
T |
 |
| Q |
218 |
tgtgtgcttcaagcttgccttatggttcaaggtcaacttttctaagagtcgtgtgatgggtgcaaatattattgatgattttataggtttggcataacga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37928628 |
tgtgtgcttcaagcttgccttatggttcaagatcaacttttctaagagtcgtgtgatgggtgcaaatattattgatgattttatagatttggcataacga |
37928529 |
T |
 |
| Q |
318 |
tttctccatggtagactgagattcttgtcgttcatct |
354 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37928528 |
tttctccatggtagactaagattcttgtcgttcatct |
37928492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University