View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_high_21 (Length: 284)
Name: NF3062_high_21
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 28811653 - 28811382
Alignment:
| Q |
1 |
ttgatgtggtaaatgaatcaataatatttcaggctaggctctgcaagggctgtgaataggcgttatatcagtgactgtgtaccattgaaacttcggatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28811653 |
ttgatgtggtaaatgaatcaataatatttcaggctaggctctgcaagggctgtgaataggcgttatatcagtgactgtgtaccattgaaacttcggatgc |
28811554 |
T |
 |
| Q |
101 |
aagcatcggccggttttgttagtgcaagtgctcttggaatggcttgtggtccagctattgcttgtttgttacagactgattttaggatttataagttgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28811553 |
aagcatcggccggttttgttagtgcaagtgctcttggaatggcttgtggtccagctattgcttgtttgttgcagactgattttaggatttataagttgac |
28811454 |
T |
 |
| Q |
201 |
aatgaaccaagacacactacctggatgggtaatggctattgcatggcttgtttatctactgtggttgtgcct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28811453 |
aatgaaccaagacacactacctggatgggtaatggctattgcatggcttgtttatctactgtggttgtgcct |
28811382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 59 - 152
Target Start/End: Original strand, 19262272 - 19262365
Alignment:
| Q |
59 |
ggcgttatatcagtgactgtgtaccattgaaacttcggatgcaagcatcggccggttttgttagtgcaagtgctcttggaatggcttgtggtcc |
152 |
Q |
| |
|
|||||||||| ||||| ||||| ||| ||||| | || ||||||||||| ||||||||||||||||| |||||||| |||||||| || ||||| |
|
|
| T |
19262272 |
ggcgttatattagtgattgtgttccactgaaaatccgcatgcaagcatcagccggttttgttagtgctagtgctctcggaatggcatgcggtcc |
19262365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 97 - 152
Target Start/End: Complemental strand, 44982684 - 44982629
Alignment:
| Q |
97 |
atgcaagcatcggccggttttgttagtgcaagtgctcttggaatggcttgtggtcc |
152 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
44982684 |
atgcaagcatcggcaggttttgttagtgccagcgctcttggaatggcttgtggtcc |
44982629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University