View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_high_29 (Length: 250)
Name: NF3062_high_29
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 3 - 244
Target Start/End: Original strand, 13087753 - 13087994
Alignment:
| Q |
3 |
ggaaatgtggatgccttcaccggacgtggaccatgcatcaaatcacgtgtttgccgcctcaacctcgcctcagacggatctgggtaccaccatgggtggt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087753 |
ggaaatgtggatgccttcaccggacgtggaccatgcatcaactcacgtgtttgccgcctcaacctcgcctcagacggatctgggtaccaccatgggtggt |
13087852 |
T |
|
| Q |
103 |
actgcgactacgtggaggtcacctccactggtccccacaaaccttgttcccaaaccatcttctatgttgatgagtggcttgccaaagatgttgcacccta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13087853 |
actgcgactacgtggaggtcacctccactggtccccacaaaccttgttcccaaaccatcttctatgttgatcagtggcttgccaaagatgttgcacccta |
13087952 |
T |
|
| Q |
203 |
taacctcagtgttatcattgatcgttgtcgtctctctgctcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13087953 |
taacctcagtgttatcattgatcgttgtcgtctcactgctcc |
13087994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University