View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_23 (Length: 292)
Name: NF3062_low_23
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 25 - 275
Target Start/End: Original strand, 39292792 - 39293041
Alignment:
| Q |
25 |
cctgatgtagtgcatcactcttaaggatagtttcgtgagggagatgaatgttttgctctttcttttcattattggcagccatatctctctctagtgtgtt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39292792 |
cctgatgtagtgcatcactcttaaggatagtttcgtgagggagatgaatgttttgctctttcttttcattattggcagccatatctctctctagtgtgtt |
39292891 |
T |
 |
| Q |
125 |
tacttatcttaattttcttgaactatgaaaagctctctcaatgatgaaacttaatgctccaaaaagctgttggcgagtgtggtgtcatagacaaattctt |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
39292892 |
tacttatcttaattttcttggactatgaaaagctctctcaatgatgaaacttaatgctccaaaaagctgtcggcgagtgtgttgtcatagacaaattctt |
39292991 |
T |
 |
| Q |
225 |
tcattttcgtttgattaattaatttaaaatttataaaaatttcagaagggt |
275 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39292992 |
tcattttcgtttgattaattaa-ttaaaatttataaaaatttcagaagggt |
39293041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University