View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_28 (Length: 264)
Name: NF3062_low_28
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 15 - 264
Target Start/End: Complemental strand, 42012888 - 42012641
Alignment:
| Q |
15 |
atttcacacttcttgagagacctgtatgaaatatgttacnnnnnnnnnatcgatgaaatttgtcatctaaatcaatgatataaacaacttaactttaaag |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42012888 |
atttcacacttcttgagaggcctgtatgaaatatgtta-gttttttttatcgatgaaatttgtcatctaaatcaatgatataaacaacttaactttaaag |
42012790 |
T |
 |
| Q |
115 |
aattaatattannnnnnngctacctnnnnnnntgtcttaacnnnnnnnatctcttatcttatattttgggttcatattggtcccttaacacatacaaaaa |
214 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42012789 |
aattaatattatttttt-gctacctaaaaaaatgtcttaactttttttatctcttatcttatattttgggttcatattggtcccttaacacatacaaaaa |
42012691 |
T |
 |
| Q |
215 |
tgtgtctattgatcacttaattcgatcaagagaaatgatatttgtacaac |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42012690 |
tgtgtctattgatcacttaattcgatcaagagaaatgatatttatacaac |
42012641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University