View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_35 (Length: 250)
Name: NF3062_low_35
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_35 |
 |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 234
Target Start/End: Complemental strand, 42446160 - 42445935
Alignment:
| Q |
9 |
gaacctgtggcaaaaagatttgccggctgaagtgtttcatcgacaatgagtttgttttctaaatttagtgtgtctgcagaagtcattatggcagatttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446160 |
gaacctgtggcaaaaagatttgccggctgaagtgtttcatcgacaatgagtttgttttctaaatttagtgtgtctgcagaagtcattatggcagatttta |
42446061 |
T |
 |
| Q |
109 |
tggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatgtgggcatgacattgatgtgcctgacataatgttgaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446060 |
tggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatgtgggcatgacattgatgtgcctgacataatgttgaaatt |
42445961 |
T |
 |
| Q |
209 |
tagttttgaattggtgttgttatcca |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42445960 |
tagttttgaattggtgttgttatcca |
42445935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 102 - 202
Target Start/End: Original strand, 3207862 - 3207962
Alignment:
| Q |
102 |
gattttatggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatgtgggcatgacattgatgtgcctgacataatgt |
201 |
Q |
| |
|
|||||||| || ||||| |||||||| ||||||||| |||| | |||||| ||||||||||||||||| || ||||||||||| || ||||| || |||| |
|
|
| T |
3207862 |
gattttatagcagctggagaccaatctggatgagagtttttcaacaaagcagcaatgccactaagatgaggacatgacattgaggtacctgaaattatgt |
3207961 |
T |
 |
| Q |
202 |
t |
202 |
Q |
| |
|
| |
|
|
| T |
3207962 |
t |
3207962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 190
Target Start/End: Complemental strand, 3179090 - 3179002
Alignment:
| Q |
102 |
gattttatggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatgtgggcatgacattgatgtgcc |
190 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||| ||||||| ||| || ||||||||||| ||||| || || |||||||| ||||| |
|
|
| T |
3179090 |
gattttattgcagctggcgaccaatcaggatgagaacttttgatcaatgcagcaatgccactgagatgaggacaagacattgaagtgcc |
3179002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 190
Target Start/End: Original strand, 3239750 - 3239838
Alignment:
| Q |
102 |
gattttatggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatgtgggcatgacattgatgtgcc |
190 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||| ||||||| ||| || ||||||||||| ||||| || || |||||||| ||||| |
|
|
| T |
3239750 |
gattttattgcagctggcgaccaatcaggatgagaacttttgatcaatgcagcaatgccactgagatgaggacaagacattgaagtgcc |
3239838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 3201888 - 3201955
Alignment:
| Q |
102 |
gattttatggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccactaagatg |
169 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||| |||| | |||||| ||||||||||||||||| |
|
|
| T |
3201888 |
gattttatagctgctggtgaccaatctggatgcgagtttttcaacaaagcagcaatgccactaagatg |
3201955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 3225703 - 3225764
Alignment:
| Q |
102 |
gattttatggctgctggtgaccaatcaggatgagagcttttgagcaaagccgcaatgccact |
163 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||| ||| || ||||| ||||| |
|
|
| T |
3225703 |
gattttatagcggctggtgaccaatcaggatgagaacttttgatcaatgcagcaataccact |
3225764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 207
Target Start/End: Original strand, 5725700 - 5725736
Alignment:
| Q |
171 |
gggcatgacattgatgtgcctgacataatgttgaaat |
207 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
5725700 |
gggcatgacatggatgtgcctgagataatgttgaaat |
5725736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 146 - 207
Target Start/End: Complemental strand, 68220 - 68159
Alignment:
| Q |
146 |
caaagccgcaatgccactaagatgtgggcatgacattgatgtgcctgacataatgttgaaat |
207 |
Q |
| |
|
||||||||| | ||||| | ||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
68220 |
caaagccgctaatccacttacatgagggcatgacatggatgtgcctgagataatgttgaaat |
68159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 134
Target Start/End: Complemental strand, 18214797 - 18214753
Alignment:
| Q |
90 |
gtcattatggcagattttatggctgctggtgaccaatcaggatga |
134 |
Q |
| |
|
||||| || ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
18214797 |
gtcatgatagcagattttatagctgcaggtgaccaatcaggatga |
18214753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University