View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_39 (Length: 246)
Name: NF3062_low_39
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 24896336 - 24896120
Alignment:
| Q |
14 |
gaagttacaatagtcatcggaaactcacacacataagcggaggagtcagagttcgaacgccggtcacggtgtacgacttgataatttcggtatttttgtc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24896336 |
gaagttacaatagtcatcggaaactcacacacataagcggaggagtcagagttcgaacgccggtcacagtgtacgacttgataatttcggtatttttgtt |
24896237 |
T |
|
| Q |
114 |
ggatgagataagacttgtggatccggccctctatttgtcccaactaaacactaaacaagtaagttataaaataaggcgtgcaggaattagataaaaacaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24896236 |
ggatgagataagacttgtggatccggccctctatttgtcccaactaaacactaaacaagtaagttataaaataaggcgtgcaggaattagataaaaacaa |
24896137 |
T |
|
| Q |
214 |
tttggaagggaaattac |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24896136 |
tttggaagggaaattac |
24896120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University