View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_40 (Length: 245)
Name: NF3062_low_40
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 50363572 - 50363758
Alignment:
| Q |
2 |
ctctgatctagtttagcttgttagatcttaagttttagttagttgggaatctgttgagatctagaatttacaacatatactatctcttccctctttgtaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50363572 |
ctctgatctagtttagcttgttagatcttaagttttagttagttgggaatctgttgagatctagaatttacaatatatactatctcttccctctttgtaa |
50363671 |
T |
 |
| Q |
102 |
ctttgatgaatgaaattcagttgcatagttagtaaacactttgttcttgatagttattactaaaggtcgcctccagacaggttgcag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50363672 |
ctttgatgaatgaaattcagttgcatagttagtaaacactttgttcttgatagttattactaaaggtcgcctccagacaggttgcag |
50363758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 239
Target Start/End: Original strand, 50363802 - 50363845
Alignment:
| Q |
196 |
ttctagtgctggaagacttattgggtgttggtaatatcattcat |
239 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50363802 |
ttcttgtgctggaagacttcttgggtgttggtaatatcattcat |
50363845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University