View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_54 (Length: 227)
Name: NF3062_low_54
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 32682954 - 32682997
Alignment:
| Q |
169 |
ggcaagttttttcatgaaatgttaacaatgttaatgggggctga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
32682954 |
ggcaagttttttcatgaaatgttaacaaagtttatggggtctga |
32682997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University