View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_55 (Length: 221)
Name: NF3062_low_55
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 29968045 - 29968250
Alignment:
| Q |
15 |
atgaatttacgctgttaaattttgaagttgaattggacctaagtattttgaagtaattttaattcactgtattgattcaagtagggcttactcagttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29968045 |
atgaatttacgctgttaaattttgaagttgaattggacctaagtattttgaagtaattttaattcactgtattgattcaagtagggcttactcagttatt |
29968144 |
T |
|
| Q |
115 |
tgaacttagcttgaggattagggcaaataatttgacatctgatttgcatcattttttacaaattaattgggatgataacnnnnnnnnttggcccggatga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29968145 |
tgaacttagcttgaggattagggcaaataatttgacatctgatttgcatcattttttacaaattaattgggatgataacaaaaaaaattggcccggatga |
29968244 |
T |
|
| Q |
215 |
aaaata |
220 |
Q |
| |
|
|||||| |
|
|
| T |
29968245 |
aaaata |
29968250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University