View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3062_low_56 (Length: 218)
Name: NF3062_low_56
Description: NF3062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3062_low_56 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 29966602 - 29966820
Alignment:
| Q |
1 |
ataatgtcacactaacttgtgattgtatgagttgcaaacttgctaagaggtgttgagaatttgggagagaatgtatgagaatttatagttgcaacttgca |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29966602 |
ataatgtcactctaacttgtgattgtatgagttgcaat-ttgcaaagagatgttgagaatttgggagagaatgtatgagaatttatagttgcaacttgca |
29966700 |
T |
 |
| Q |
101 |
aagaagtgttgggaatttgggagagaatgtgtggggatttataagagatga--gtgtgtgtgcgtatgtgagtgattaattaatgtggcaaattgtaagg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29966701 |
aagaagtgttgggaatttgggagagaatgtgtgggaatttataagagaggagtgtgtgtgtgcgtatgcgagtgattaattaatgtggcaaattgtaagg |
29966800 |
T |
 |
| Q |
199 |
tggaaaagtcatcttcaaac |
218 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29966801 |
tggaaaagtcatcttcaaac |
29966820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University