View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_high_13 (Length: 424)
Name: NF3063_high_13
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 405; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 35274690 - 35274274
Alignment:
| Q |
1 |
ttatttgtttctccttcgtcttattttatatgtttttagattaagatagcaacggtacccattgttctgtttgaattttacgtctgaatgttacatccca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35274690 |
ttatttgtttctctttcgtcttattttacatgtttttagattaagatagcaacggtacccattgttctgtttgaattttacgtctgaatgttacatccca |
35274591 |
T |
 |
| Q |
101 |
gattcgtgctcgtgagtggctcttcttttctgaagaaggacaatggatggtagtcagaagctccaaagcagctcgtctcataatggtactatgttattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35274590 |
gattcgtgctcgtgagtggctcttcttttctgaagaaggacaatggatggtagtcagaagctccaaagcagctcgtctcataatggtactatgttattaa |
35274491 |
T |
 |
| Q |
201 |
cttaatgaaataatattttctggtattttggtgttacttttataattgaactttttgaacacatctcacctttaggttttcttggacaccagccatacta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35274490 |
cttaatgaaataatattttctggtattttggtgttacttttataattgaactttttgaacacatctcacctttaggttttcttggacaccagccatacta |
35274391 |
T |
 |
| Q |
301 |
atgccagcatggatgagattcaggtagaaacatcatcttaagttatgccattcaaacagattaactattactgaattgtgtgttgttatcccttttcaga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35274390 |
atgccagcatggatgagattcaggtagaaacatcatcttaagttatgccattcaaacagattaactattactgaattgtgtgttgttatcccttttcaga |
35274291 |
T |
 |
| Q |
401 |
aggatttgtctctgctg |
417 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
35274290 |
aggatttgtctccgctg |
35274274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University