View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_high_29 (Length: 270)
Name: NF3063_high_29
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 9405025 - 9405267
Alignment:
| Q |
18 |
tatatttgctgaagttcatttgtgtttgtggtcttattagttcattggagaagaaacgacagctgcttttggaactacagaacttaccgatgatcccaca |
117 |
Q |
| |
|
||||||||| || |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9405025 |
tatatttgccgacgttcatttgtatttgtggtcttattagttcattggagaagaaacaacagctgcttttggaactacagaacttaccgatgatcccaca |
9405124 |
T |
|
| Q |
118 |
tggattgttgatccccttgatggaactactaactttgtgcatgggtaagcagtattgctgacattttcattgatcgtgattatggatactcatatttata |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9405125 |
tggattgttgatcccctcgatggaactactaactttgtgcatgggtaagcagtattgctgacattttcattgatggtgattatggatactcatatttata |
9405224 |
T |
|
| Q |
218 |
tattgatggactataaattatactatctgtaggttcccctttg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9405225 |
tattgatggactataaattatactatctgtaggttcccctttg |
9405267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University