View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_high_41 (Length: 238)
Name: NF3063_high_41
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 9011146 - 9011268
Alignment:
| Q |
26 |
ttttaaattaacccgta---aagcactaaaatatagaatttctctcttttttaatctcaccaaactaccttttgcaaaacaaatttaacaactattatga |
122 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9011146 |
ttttaaattaacccgtactaaagcactaaaatatagaatttctctcttttttaatctcaccaaactaccttttgcaaaacaaatttaacaactattatga |
9011245 |
T |
|
| Q |
123 |
ataaaaagataccgttgataatt |
145 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
9011246 |
ataaaaagataacgttgataatt |
9011268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University