View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3063_high_41 (Length: 238)

Name: NF3063_high_41
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3063_high_41
NF3063_high_41
[»] chr7 (1 HSPs)
chr7 (26-145)||(9011146-9011268)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 9011146 - 9011268
Alignment:
26 ttttaaattaacccgta---aagcactaaaatatagaatttctctcttttttaatctcaccaaactaccttttgcaaaacaaatttaacaactattatga 122  Q
    |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9011146 ttttaaattaacccgtactaaagcactaaaatatagaatttctctcttttttaatctcaccaaactaccttttgcaaaacaaatttaacaactattatga 9011245  T
123 ataaaaagataccgttgataatt 145  Q
    ||||||||||| |||||||||||    
9011246 ataaaaagataacgttgataatt 9011268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University