View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_high_43 (Length: 236)
Name: NF3063_high_43
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 44690901 - 44690676
Alignment:
| Q |
1 |
ctattatccttttcgtattaacatgggcgacaacggaagagaagaagggaaaacacg-------tcnnnnnnnnnnnnnncgaaagcaagatctttaatc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| ||||||| |
|
|
| T |
44690901 |
ctattatccttttcgtattaacatgggcgacaacggaagagaagaagggaaaacacgttttttttttttttttttttttccggaagcaagatgtttaatc |
44690802 |
T |
|
| Q |
94 |
taatgaagtggtttttacatatcatattagttattacttcgatatcatagaagaattgttgctgaataatttcatattattgatgagtgaatnnnnnnnt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
44690801 |
taatgaagtggtttttacatatcatattagttattacttcgatatcatagaataattgttgctgaataatttcatgttattgatgagtgaat-aaaaaat |
44690703 |
T |
|
| Q |
194 |
aaatgaagtggtttttgtagaatagca |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44690702 |
aaatgaagtggtttttgtagaatagca |
44690676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University