View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_12 (Length: 441)
Name: NF3063_low_12
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 194 - 431
Target Start/End: Complemental strand, 15303932 - 15303696
Alignment:
| Q |
194 |
catcaaattattccactccctttaggttacattatcattgacgtaatcaaacacgccgatttctctgaatgcttatacggtttaggggtacgtatatata |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15303932 |
catcaaattattccactccctttaggttacatgatcattgacatgatcaaacacaccgatttctctgaatgcttatacgatttaggggtacgtatatata |
15303833 |
T |
 |
| Q |
294 |
tcacttctggttatatgcttcaattgttgcattcttttccttttgaacgaacactgttactgttattttctttgtttttcttgttttagatgtgtgctaa |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15303832 |
tcacttctggttatatgcttcaattgttgcattcttttccttttgaactaa-actaacactgttattttctttgtttttcttgtcttagatgtgtgctaa |
15303734 |
T |
 |
| Q |
394 |
agaactcataattcctagtgatacccctgatccctatg |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15303733 |
agaactcataattcctagtgatacccctgatccctatg |
15303696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 22 - 128
Target Start/End: Complemental strand, 15304147 - 15304041
Alignment:
| Q |
22 |
ccgaaatatgcccctctctcgtaaacaagatctccaatgtcttgttcataactgaaaccatcgcaggaaagattttctatgttctttacttcactggagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15304147 |
ccgaaatatgcccctctctcgtaaacaagatctccaatgtcttgttcataactgaaaccatcgcaggaaagattttctatgttctttacttcactggagc |
15304048 |
T |
 |
| Q |
122 |
aagtact |
128 |
Q |
| |
|
|||||| |
|
|
| T |
15304047 |
gagtact |
15304041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University