View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_28 (Length: 312)
Name: NF3063_low_28
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 293
Target Start/End: Original strand, 13099779 - 13100064
Alignment:
| Q |
8 |
tgagatgaaggtagtaggcttgatagggtcatggtatatgatggttggtttcgactgctgggggtcgacaagtatgtgggcttttgatagagaagttttt |
107 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13099779 |
tgagatgaaggtagcaggcttgatcgggtcatggtatatgatggttggtttcgactgctgggggtcgacaagtatgtgggcttttgatagagaagttttt |
13099878 |
T |
 |
| Q |
108 |
gatcaatgccctttgacgttgaagtactctagtcatctatgaggtcccaaaaattttagccggggagaaaaattaaagagaatgtattattaaatcatga |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13099879 |
gatcaatgtcctttgacgttgaagtactctagtcatctatgaggtcccaaaaattttagccggggagaaaaattaaagagaatgtattattaaatcatga |
13099978 |
T |
 |
| Q |
208 |
tctgaatattttactttggaggaagtggactgtattattaaatcatgttctaatttatgggttttattacaataagattacattac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13099979 |
tctgaatattttactttggaggaagtggactgtattattaaatcatgttcaaatttatgggttttattacaataagattacattac |
13100064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University