View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_47 (Length: 235)
Name: NF3063_low_47
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 44690882 - 44691104
Alignment:
| Q |
1 |
taatacgaaaaggataacagttccaaacatcgaagttccaccattggagcttcctctacaagaaaagatccagcattaaactcgcagctcttgttatctt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44690882 |
taatacgaaaaggataatagttccaaacatcgaagttccaccattggagcttcctctacaagaaaagatccagcattaaactcgcagttcttgttatctt |
44690981 |
T |
|
| Q |
101 |
catcctgggaagaatatagttaaatcctagttgttcctcaccataacaagagcagccctctatgggcattaatgcatcatgannnnnnnnataaacgata |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44690982 |
catcctggggagaatatagttaaatcctagttgttcctcaacat----agagcagccctctatgggcattaatgcatcatgattttttttataaacgata |
44691077 |
T |
|
| Q |
201 |
aatgagagatgaattagttatgatgat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44691078 |
aatgagagatgaattagttatgatgat |
44691104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University