View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_52 (Length: 227)
Name: NF3063_low_52
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_52 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 31486640 - 31486860
Alignment:
| Q |
7 |
ctttggcatcaacaactgctctgctatctaaagaaagcctaggagcctctcttgagaatttccatgaagaccttgtaccttccttaagttccagaacagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31486640 |
ctttggcatcaacaactgctctgctatctaaagaaagcctaggagcctctcttgagaatttccatgaagaccttgtaccttccttaagttccagaacagg |
31486739 |
T |
 |
| Q |
107 |
aaggacttgttttggttcacttttgatctctttaaccggtgacggtgatgacaacaccggtttgccatcatctttctctgatttctccggtgacggctgt |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31486740 |
aaggacttgttttgtttcacttttgatctctttaaccggtgacggtgatgaaaacaccggtttgccatcatctttctctgatttctccggtgaaggctgt |
31486839 |
T |
 |
| Q |
207 |
aaaaagaaaacaatagagatt |
227 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
31486840 |
aaaaacaaaacaatagagatt |
31486860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University