View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3063_low_56 (Length: 221)

Name: NF3063_low_56
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3063_low_56
NF3063_low_56
[»] chr5 (1 HSPs)
chr5 (3-205)||(2957335-2957534)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 3 - 205
Target Start/End: Original strand, 2957335 - 2957534
Alignment:
3 gatgaaccaaattaaggtccgacaattcctctaatatgattatatattgtagagaaagtttatggaaaacatcaatnnnnnnntatgatagaagaagt-- 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       |||||||||||||||      
2957335 gatgaaccaaattaaggttcgacaattcctctaatatgattatatattgcagagaaagtttatggaaaacatcaatgaaaaaatatgatagaagaagtaa 2957434  T
101 gataatattaannnnnnnnnagtaaatatcaactttatatatactatatagtatttgggttgagtttaactcaagttttataaaacatataacttgtgag 200  Q
     ||||||||||         ||||||||||||||||||||||||||||||  || ||||||||||||||||||||||||||||| |  ||||||||||||    
2957435 tataatattaa-ttttttttagtaaatatcaactttatatatactatata--atatgggttgagtttaactcaagttttataaatc--ataacttgtgag 2957529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University