View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_56 (Length: 221)
Name: NF3063_low_56
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 3 - 205
Target Start/End: Original strand, 2957335 - 2957534
Alignment:
| Q |
3 |
gatgaaccaaattaaggtccgacaattcctctaatatgattatatattgtagagaaagtttatggaaaacatcaatnnnnnnntatgatagaagaagt-- |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2957335 |
gatgaaccaaattaaggttcgacaattcctctaatatgattatatattgcagagaaagtttatggaaaacatcaatgaaaaaatatgatagaagaagtaa |
2957434 |
T |
 |
| Q |
101 |
gataatattaannnnnnnnnagtaaatatcaactttatatatactatatagtatttgggttgagtttaactcaagttttataaaacatataacttgtgag |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2957435 |
tataatattaa-ttttttttagtaaatatcaactttatatatactatata--atatgggttgagtttaactcaagttttataaatc--ataacttgtgag |
2957529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University